trpF

trpF
168

phosphoribosylanthranilate isomerase

locus
BSU_22650
Molecular weight
23.91 kDa
pI
8.37
Protein length
Gene length
function
biosynthesis of tryptophan
product
phosphoribosylanthranilate isomerase
essential
no
ec
5.3.1.24
synonyms
trpF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0135 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,373,487 → 2,374,134
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
N-(5-phospho-β-D-ribosyl)anthranilate --> 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate (according to UniProt)
Protein family
TrpF family (single member, according to UniProt)
Structure
[PDB|1DL3] (from Thermotoga maritima, 33% identity) [pubmed|10745009]
[AF|P20167]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]

2024-06-29 21:10:38

Jstuelk

64

53eef6e8739e58d1bed57b78e584c86a2e6ff379

37D11B58C2266E362D5C193ADEA68D53F64A90E3

genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2024-07-07 05:55:35

Jstuelk

88

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

Biological materials
Mutant
BKE22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA,  downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
BKK22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA,  downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
References
Reviews
12966138
Original Publications
14976255,3924737,6436812,2422155,8419914,1551827,21815947,10745009

C6872585F9BD3717A4F49E96F7684C4A5AD1760D

Page visits: 2861

Time of last update: 2024-07-15 05:34:58

Author of last update: Melvin.boenninger