

anthranilate synthase (subunit I)

Molecular weight
57.95 kDa
Protein length
Gene length
biosynthesis of tryptophan
anthranilate synthase (subunit I)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0147 (Galperin et al., 2021)

This gene is a member of the following regulons

2,375,869  2,377,416
Visit Visit
The protein
Catalyzed reaction/ biological activity
chorismate + L-glutamine --> anthranilate + H+ + L-glutamate + pyruvate (according to UniProt)
Protein family
Anthranilate synthase component I family (with [protein|B189AD3E3D18876E1956763182D835A151727392|pabB], according to UniProt)
[PDB|1I7Q] (from ''Serratia marcescens'', 42% identity, 62% similarity) [Pubmed|11371633]
Effectors of protein activity
subject to feedback inhibtion by tryptophan [Pubmed|4956345]
Expression and Regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab


2024-06-29 21:10:38





not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab


2024-07-07 05:55:35





Biological materials
BKE22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG,  downstream forward: _UP4_GCTGATGAACAGATTTCTAC
BKK22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG,  downstream forward: _UP4_GCTGATGAACAGATTTCTAC
Other original publications
The ''trpE'' [wiki|RNA switch]


Page visits: 4800

Time of last update: 2024-07-15 00:47:10

Author of last update: Melvin.boenninger