

anthranilate phosphoribosyltransferase

Molecular weight
35.87 kDa
Protein length
Gene length
biosynthesis of tryptophan
anthranilate phosphoribosyltransferase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0547 (Galperin et al., 2021)

This gene is a member of the following regulons

2,374,881  2,375,897
Visit Visit
The protein
Catalyzed reaction/ biological activity
diphosphate + N-(5-phospho-β-D-ribosyl)anthranilate --> 5-phospho-α-D-ribose 1-diphosphate + anthranilate (according to UniProt)
Protein family
anthranilate phosphoribosyltransferase family (single member, according to UniProt)
[PDB|4YI7] (from Acinetobacter sp., 42% identity)
Expression and Regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab


2024-06-29 21:10:38





not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: transcription termination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab


2024-07-07 05:55:35





Biological materials
BKE22670 ([gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCACCGGCAGTAAGGGTTT,  downstream forward: _UP4_CTAAAGCAGAAAGAGGAAGA
BKK22670 ([gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCACCGGCAGTAAGGGTTT,  downstream forward: _UP4_CTAAAGCAGAAAGAGGAAGA
Original Publications


Page visits: 2490

Time of last update: 2024-07-14 15:07:38

Author of last update: Melvin.boenninger