

threonine synthase, has a minor threonine dehydratase ([protein|D0CF32BF81AA1DC7BBBC3E9B667A54F97260DF3F|ilvA]) activity

Molecular weight
37.31 kDa
Protein length
Gene length
biosynthesis of threonine
threonine synthase
thrC, thrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0498 (Galperin et al., 2021)

This gene is a member of the following regulons

3,313,770 3,314,828
Phenotypes of a mutant
auxotrophic for threonine [pubmed|32743959]
Visit Visit
The protein
Catalyzed reaction/ biological activity
O-phospho-L-homoserine + H2O --> L-threonine + phosphate (according to UniProt)
has additional threonine dehydratase activity [pubmed|27260660]
Protein family
threonine synthase family (single member, according to UniProt)
[PDB|6CGQ] (complexed with PLP and PLP-Ala) [pubmed|30830751]
[PDB|6NMX] (complexed with PLP and (Z)-L-2-amino-5-phosphono-3-pentenoic acid (APPA)) [Pubmed|30830751]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
expressed during [wiki|sporulation] [Pubmed|22383849]
Open in new tab


2024-05-22 02:10:26





expressed in the presence of lysine or cysteine ([wiki|ThrR]) [Pubmed|27260660]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24163341], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]: repression, [Pubmed|27260660], in [regulon|protein:A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR regulon]
Open in new tab


2024-05-20 16:56:04





Biological materials
GP3030 [gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::''spc'', available in [wiki|Jrg Stlke]'s lab [pubmed|32743959]
1A773 (''thrC''::''cat''), [Pubmed|8973347], available at [ BGSC] and in [wiki|Jrg Stlke]'s lab
BKE32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG
BKK32250 ([gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGATGGATAAGTCCTTTCC, downstream forward: _UP4_TATGTAAAAGGAGCGGCCCG


Page visits: 5953

Time of last update: 2024-05-23 04:02:49

Author of last update: Jstuelk