

glycerol kinase

Molecular weight
54.91 kDa
Protein length
Gene length
glycerol utilization
glycerol kinase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0554 (Galperin et al., 2021)

This gene is a member of the following regulons

1,003,344 → 1,004,834
Visit Visit
The protein
Catalyzed reaction/ biological activity
ATP + glycerol --> ADP + H+ + sn-glycerol 3-phosphate (according to UniProt)
Protein family
[wiki|FGGY kinase family] (according to UniProt)
[PDB|3H46] (from ''Enterococcus casseliflavus'', complex with glycerol) [Pubmed|19102629]
phosphorylation (His230) (according to Swiss-Prot)
Expression and Regulation
induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]) [Pubmed|8436953]
repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [pubmed|28439033,10913079]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]-dependent [wiki|RNA switch], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: repression, [pubmed|28439033], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2127799], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-02 16:00:25





Biological materials
BKE09290 (''glpK''::''ermC'') (available at the [ BGSC] and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
GP1865 (''glpK''::''ermC'') (available in [wiki|Jörg Stülke]'s lab)
BKE09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT,  downstream forward: _UP4_TAAAGTAATACTATGGTATA
BKK09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT,  downstream forward: _UP4_TAAAGTAATACTATGGTATA
[wiki|Josef Deutscher], Paris-Grignon, France


Page visits: 5000

Time of last update: 2024-07-15 04:48:44

Author of last update: Jstuelk