glpF

glpF
168

glycerol facilitator

locus
BSU_09280
Molecular weight
28.59 kDa
pI
9.51
Protein length
Gene length
function
glycerol uptake
product
glycerol facilitator
essential
no
synonyms
glpF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0580 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,002,501 → 1,003,325
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
MIP/aquaporin (TC 1.A.8) family (single member, according to UniProt)
Structure
[PDB|1FX8] (the protein from ''E. coli'', 37% identity) [Pubmed|11039922]
[AF|P18156]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]-[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]
description
[Pubmed|2127799]
regulation
induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]) [Pubmed|8436953]
repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [pubmed|28439033,10913079]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]-dependent [wiki|RNA switch], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: repression, [pubmed|28439033], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2127799], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]→[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]

2024-07-02 16:00:25

Jstuelk

61

6bf7a6adce5be71e9abc912fb73d3b1b2e5ccd51

B119561C74406339EE9BD741552115416313624C

additional information
increased expression at increased temperature (via an RNA thermometer that covers the Ribosomal binding site of the mRNA) [pubmed|37217261]
Biological materials
Mutant
GP99 (cat) (available in [wiki|Jörg Stülke]'s lab)
BKE09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA,  downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
BKK09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09280 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA,  downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
References
12850135,8436953,11929549,23033921,22900538,20817675,11039922,28439033,10913079,37217261

B12432503801FA766D6FC90359A22A53A8E92457

Page visits: 5002

Time of last update: 2024-07-13 19:08:47

Author of last update: Jstuelk