pabA

pabA
168

para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II)

locus
BSU_00750
Molecular weight
21.54 kDa
pI
4.78
Protein length
Gene length
function
biosynthesis of folate and tryptophan
product
para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II) glutamine amidotransferase (subunit B) and anthranilate synthase (subunit II)
essential
no
ec
2.6.1.85
synonyms
pabA, trpG, trpX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0512 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
84,290  84,874
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Chorismate + L-glutamine --> anthranilate + pyruvate + L-glutamate (according to UniProt)
[wiki|Domains]
[wiki|Glutamine amidotransferase type-1 domain] (aa 1-194) (according to UniProt)
Structure
[PDB|1I1Q] (from ''Salmonella typhimurium'', 42% identity) [Pubmed|11224570]
[AF|P28819]
Expression and Regulation
Operons
genes
[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|dusB1]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
description
[Pubmed|9084182]
regulation
translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|9084182]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9084182], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|B189AD3E3D18876E1956763182D835A151727392|pabB]→[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]

2024-06-15 21:39:51

Jstuelk

95

8c465dd3eec1aaa32d5e91206834f9bb99ef474a

7B9041CE94396BF42D285F7C0EDD3A2544761EEE

Other regulations
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: translation inhibition, [Pubmed|9084182]
additional information
the [gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC] part of the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Biological materials
Mutant
BKE00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC,  downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
BKK00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC,  downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
References
Reviews
16285852,19385727
Original Publications
8647825,7515880,9084182,17114263,21815947,11224570

956E33AAAADB302EB8663E4B75C917242D3AD2C0

Page visits: 3339

Time of last update: 2024-07-14 17:00:59

Author of last update: Melvin.boenninger