

lactate catabolic enzyme

Molecular weight
26.24 kDa
Protein length
Gene length
lactate utilization
lactate oxidase
lutA, yvfV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0247 (Galperin et al., 2021)

This gene is a member of the following regulons

3,494,985 → 3,495,701
Phenotypes of a mutant
no growth with lactate as the single carbon source [Pubmed|19201793]
Visit Visit
The protein
Catalyzed reaction/ biological activity
oxidation of lactate to pyruvate [Pubmed|19201793]
Protein family
LutA/YkgE family (single member, according to UniProt)
[PDB|5ODC] (from Methanothermococcus thermoautotrophicus, 24% identity) [pubmed|28818947]
Expression and Regulation
induction by lactate [Pubmed|19201793]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|19201793], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-21 19:16:01





Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|22427629]
[protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]: translation inhibition
Biological materials
MGNA-A497 (yvfV::erm), available at the [ NBRP B. subtilis, Japan]
BKE34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
BKK34050 (Δ[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGAACCCCTCTCTCA,  downstream forward: _UP4_TAAAACTGGATTCAGAGGGG
lacZ fusion
GP1612 amyE::p(lutA-lacZ cat), constructed with pGP2149 based on [wiki|pAC5], available in [wiki| Jörg Stülke]'s lab
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]


Page visits: 4711

Time of last update: 2024-07-13 19:10:28

Author of last update: Jstuelk