pbpE

pbpE
168

Class C penicillin-binding protein PBP 4*

locus
BSU_34440
Molecular weight
51.27 kDa
pI
4.84
Protein length
Gene length
function
endopeptidase
product
penicillin-binding protein PBP 4*
essential
no
synonyms
pbpE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1680 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,534,118 3,535,473
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|beta-lactamase family] (according to UniProt)
Structure
[PDB|3TG9] (from ''Bacillus halodurans'', 27% identity, 59% similarity)
[AF|P32959]
[wiki|Localization]
cell membrane (according to UniProt)
distinct foci and bands at cell periphery [pubmed|15758244]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]-[gene|2ABCC493C6CA847A7BC65B1200A9B6490621462A|racX]
description
[Pubmed|8491712]
regulation
induced by cell wall stress ([protein|search|SigW]) [Pubmed|8491712,12207695]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|8491712,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]→[gene|2ABCC493C6CA847A7BC65B1200A9B6490621462A|racX]

2024-05-21 05:00:01

ghost

67

1f8e3fc20860381d76ed70a1b2c4e36c63dfb443

0F6A2822B6094BF894F47F8B2DD42116C14C544F

Biological materials
Mutant
BKE34440 ([gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCCACCTCCCATAT, downstream forward: _UP4_ACGAAGTAGAAAGGAATGAA
BKK34440 ([gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCCACCTCCCATAT, downstream forward: _UP4_ACGAAGTAGAAAGGAATGAA
GFP fusion
3106 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::pSG5046 (cat Pxyl-gfpa-[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]1-761) [pubmed|15758244], available in [wiki|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
References
Reviews
33709487
Original Publications
8491712,12533473,9987136,19063962,12884008,12207695,7592498,20817675,15378759,15758244

FE672C27CF019E18A526DE8E6779788DDE54056E

Page visits: 3389

Time of last update: 2024-05-22 21:51:33

Author of last update: Jstuelk