hutG

hutG
168

formiminoglutamate hydrolase

locus
BSU_39380
Molecular weight
34.91 kDa
pI
5.44
Protein length
Gene length
function
histidine utilization
product
formiminoglutamate hydrolase
essential
no
ec
3.5.3.8
synonyms
hutG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0010 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,046,503 → 4,047,462
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
H2O + N-formimidoyl-L-glutamate --> formamide + L-glutamate (according to UniProt)
Protein family
arginase family (with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF] and [protein|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB], according to UniProt)
Structure
[PDB|3M1R]
[AF|P42068]
Expression and Regulation
Operons
genes
[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
description
[Pubmed|10746760]
regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]→[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]

2024-07-09 18:58:13

ghost

112

cf3eb91928f3fe61cbc0cd204535c4f9c144314a

0AE45FCE38B0E774CFFC5F6A0A98EEDF6B02F4D4

Biological materials
Mutant
BKE39380 (Δ[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGGCCTCTCTGAGAAAAG,  downstream forward: _UP4_TGATCTTCTGGCAGGTTGTA
BKK39380 (Δ[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCGGCCTCTCTGAGAAAAG,  downstream forward: _UP4_TGATCTTCTGGCAGGTTGTA
References
Reviews
22933560
Original Publications
10746760,8682780,10217782,8071225

FBB15E07B7134C57208EA82D5339708385DBC5FB

Page visits: 2775

Time of last update: 2024-07-14 23:03:24

Author of last update: Melvin.boenninger