yonG

yonG
168

unknown

locus
BSU_21100
Molecular weight
35.58 kDa
pI
4.6
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yonG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,229,988 → 2,230,908
The protein
Structure
[AF|O31951]
Biological materials
Mutant
BKE21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG,  downstream forward: _UP4_AAAATGACCTCACATAAAAA
BKK21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG,  downstream forward: _UP4_AAAATGACCTCACATAAAAA

FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E

Page visits: 1826

Time of last update: 2025-10-26 03:57:33

Author of last update: Bzhu