yonG
168
unknown
locus
BSU_21100
Molecular weight
35.58 kDa
pI
4.6
function
unknown
product
unknown
essential
no
ec
null
synonyms
yonG
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
2,229,988 → 2,230,908
The protein
Structure
[AF|O31951]
Biological materials
Mutant
BKE21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG, downstream forward: _UP4_AAAATGACCTCACATAAAAA
BKK21100 (Δ[gene|FA36B522D8A1F40E1B4A79A489238EEA8C59AF0E|yonG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCACCTCCATAAAG, downstream forward: _UP4_AAAATGACCTCACATAAAAA
Page visits: 1826
Time of last update: 2025-10-26 03:57:33
Author of last update: Bzhu