metP

metP
168

methionine [wiki|ABC transporter], permease

locus
BSU_32740
Molecular weight
23.61 kDa
pI
6.62
Protein length
Gene length
function
methionine uptake
product
methionine [wiki|ABC transporter], permease
essential
no
synonyms
metP, yusB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2011 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,362,605 → 3,363,273
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|CysTW subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 18-212) (according to UniProt)
Structure
[PDB|3DHW] (the [protein|D7254B7F31D3F4CD18172AFB0F526CAE5195BDB6|metN]-[protein|F94070DD039A422055FFC35087FB87765F22E156|metP] complex from ''E. coli'', 44% identity) [Pubmed|18621668]
[AF|O32168]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|D7254B7F31D3F4CD18172AFB0F526CAE5195BDB6|metN]-[gene|F94070DD039A422055FFC35087FB87765F22E156|metP]-[gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ]
description
[Pubmed|10094622]
regulation
activated during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12618455]
the mRNA is processed between [gene|F94070DD039A422055FFC35087FB87765F22E156|metP] and [gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination, in [regulon|other_regulator:S-box|S-box]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|D7254B7F31D3F4CD18172AFB0F526CAE5195BDB6|metN]→[gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ]

2024-06-20 01:36:46

Jstuelk

63

9ad5323c9fe97f5a93af04eabd407c1ff456e082

2838D0C991A12719802237E588CE3A803C3DF6A2

Biological materials
Mutant
MGNA-A600 (yusB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/600 NBRP B. subtilis, Japan]
1A797 ( ''metP''::''cat''), [Pubmed|14990259], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A797&Search=1A797 BGSC]
BKE32740 (Δ[gene|F94070DD039A422055FFC35087FB87765F22E156|metP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCAAACATTCGTGATCAC,  downstream forward: _UP4_GACAAACGATAAGGGAGGAT
BKK32740 (Δ[gene|F94070DD039A422055FFC35087FB87765F22E156|metP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCAAACATTCGTGATCAC,  downstream forward: _UP4_GACAAACGATAAGGGAGGAT
References
10092453,14990259,12618455,10094622,18039762,18621668,29794222

F94070DD039A422055FFC35087FB87765F22E156

Page visits: 4381

Time of last update: 2024-06-21 19:05:05

Author of last update: Melvin.boenninger