lysC

lysC
168

aspartokinase II (alpha and beta subunits)

locus
BSU_28470
Molecular weight
43.65 kDa
pI
4.64
Protein length
Gene length
function
biosynthesis of lysine
product
aspartokinase II (alpha and beta subunits)
essential
no
ec
2.7.2.4
synonyms
lysC, ask, aecA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0527 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,909,520 2,910,746
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
ATP + L-aspartate --> 4-phospho-L-aspartate + ADP (according to UniProt)
Protein family
aspartokinase family (with [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|dapG] and [protein|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD], according to UniProt)
[wiki|Domains]
two C-terminal [wiki|ACT domain]s (aa 264-337, and aa 343-408) (according to UniProt)
Structure
[PDB|2RE1] (from ''Neisseria meningitidis mc58'', 40% identity, 58% similarity)
[AF|P08495]
Effectors of protein activity
feedback inhibition by lysine [pubmed|15033471]
Paralogous protein(s)
[protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|dapG]
[wiki|Localization]
cytoplasm (according to UniProt)
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983], also degraded upon ammonium or amino acid starvation [Pubmed|2168395]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]
description
[Pubmed|19636616]
regulation
expression activated by glucose (5.4 fold) [Pubmed|12850135]
regulatory mechanism
L-box: RNA switch, via a riboswitch, in [regulon|other_regulator:L-box|L-box]
Open in new tab

[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]

2024-06-19 20:24:05

ghost

69

300373ab1da098252814f4ce9b22b68edd36c5aa

5936C60FA4565D7B120FCF2538E8C65AAD4C2B70

Biological materials
Mutant
BKE28470 ([gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
BKK28470 ([gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
References
Reviews
19946135,22079167
Research papers
15033471
The [wiki|L-box] [wiki|riboswitch]
14523230,14597663,19636616,21169337,22416067,23067368,31045204,31267846,15033471,34958583,35981263

F7B947938FB40E54D89A719E9610C5A4AA400674

Page visits: 3736

Time of last update: 2024-06-22 23:54:40

Author of last update: Jstuelk