gcvT

gcvT
168

aminomethyltransferase (glycine cleavage system protein T)

locus
BSU_24570
Molecular weight
39.62 kDa
pI
5.73
Protein length
Gene length
function
glycine utilization
product
aminomethyltransferase (glycine cleavage system protein T)
essential
no
ec
2.1.2.10
synonyms
gcvT, yqhI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0404 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,548,245 → 2,549,333
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(6S)-5,6,7,8-tetrahydrofolate + (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[protein] --> (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + (R)-N6-dihydrolipoyl-L-lysyl-[protein] + NH4+ (according to UniProt)
Protein family
gcvT family (single member, according to UniProt)
[wiki|Cofactors]
tetrahydrofolate
Structure
[PDB|1YX2]
[AF|P54378]
Expression and Regulation
Operons
genes
[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
description
[Pubmed|15472076]
regulation
induced by glycine [Pubmed|15472076]
the [wiki|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
Gly-box: RNA switch, [pubmed|31992591], in [regulon|other_regulator:Gly-box|Gly-box]
Open in new tab

[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]→[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]

2024-06-03 08:29:46

Jstuelk

55

b8399a8069749ebce96a5673beef55862123ad69

18A61526FCBD278A97D718FA1F476B3A75682C1F

Biological materials
Mutant
MGNA-C428 (yqhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2426 NBRP B. subtilis, Japan]
BKE24570 (Δ[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAATTCCTCCCCTTTA,  downstream forward: _UP4_TAATATTTTTTCTTGGAGAG
BKK24570 (Δ[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTAATTCCTCCCCTTTA,  downstream forward: _UP4_TAATATTTTTTCTTGGAGAG
lacZ fusion
pGP431 (in [wiki|pAC7]), available in [wiki|Stülke] lab
References
15096624,15472076,23249744,23721735,29794222,29089431,31992591

F6F449170276055E6D60D89E9E17A152A82CA166

Page visits: 4193

Time of last update: 2024-06-21 19:07:02

Author of last update: Jstuelk