epsA

epsA
168

extracellular polysaccharide synthesis, putative transmembrane modulator of [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB] activity, might activate [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB] autophosphorylation and substrate phosphorylation

locus
BSU_34370
Molecular weight
25.75 kDa
pI
6.07
Protein length
Gene length
function
biofilm formation
product
unknown
essential
no
synonyms
epsA, yveK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3944 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,529,151 → 3,529,855
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|capA] and [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA], according to UniProt)
CpsC/CapA family (with [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA], according to UniProt)
Structure
[AF|P71050]
Paralogous protein(s)
[protein|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2024-06-09 03:22:36

ghost

131

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-A073 (yveK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/73 NBRP B. subtilis, Japan]
GP1517 (aphA3) [Pubmed|24493247], available in [wiki| Jörg Stülke]'s lab
GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [wiki| Jörg Stülke]'s lab
GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [wiki| Jörg Stülke]'s lab
BKE34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
BKK34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]) [Pubmed|24493247], available in [wiki| Jörg Stülke]'s lab
FLAG-tag construct
GP1526 epsA-FLAG 3x spc (based on [wiki|pGP1331]) [Pubmed|24493247], available in [wiki| Jörg Stülke]'s lab
Antibody
**
GFP fusion
GP1569 epsA-gfp (spc), available in [wiki| Jörg Stülke]'s lab
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
Reviews
20735481
Original Publications
15661000,16430695,18047568,18647168,20351052,20817675,21856853,21815947,23646920,24493247,25085422,26283769,32483306

F6C4634BF871D9A01E27014FFED7527C54BF560D

Page visits: 7592

Time of last update: 2024-07-16 00:42:43

Author of last update: Jstuelk