lplJ

lplJ
168

lipoate-protein ligase

locus
BSU_10250
Molecular weight
37.86 kDa
pI
5.84
Protein length
Gene length
function
scavenging of lipoic acid
product
Lipoate:protein ligase
essential
no
synonyms
lplJ, yhfJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0095 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,099,159 → 1,100,154
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
attaches exogenous lipoic acid to  the  apoproteins  by  a  two-step ATP dependent reaction:
a) the activation of lipoic acid to lipoyl-AMP [pubmed|27074917]
b) the transfer of this activated lipoyl species to E2 subunit of 2-oxoglutarate dehydrogenase ([protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]) and  [protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH],  with  the concomitant liberation of AMP [pubmed|31066113,27074917]
(R)-lipoate + [lipoyl-carrier protein]-L-lysine + ATP --> [lipoyl-carrier protein]-(R)-N6-lipoyl-L-lysine + AMP + diphosphate + H+ (according to UniProt)
Protein family
LplA family (single member, according to UniProt)
[wiki|Domains]
[wiki|BPL/LPL catalytic domain] (aa 27-214) (according to UniProt)
Structure
[PDB|5IBY] (from Enterococcus faecalis, 59% identity)
[AF|O07608]
Expression and Regulation
Operons
genes
[gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]-[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]-[gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]
description
[Pubmed|22383849]
Open in new tab

[gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]→[gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]

2024-06-16 06:28:39

Jstuelk

73

b8823528516f22fffa10ba8fffe4e79b3d5468b4

CFCEBE535A67CD8FED72C985A24AEAD6F25506F0

Biological materials
Mutant
MGNA-B276 (yhfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1275 NBRP B. subtilis, Japan]
BKE10250 (Δ[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATAAATAACATGGTGCTCC,  downstream forward: _UP4_TAAGGCAAAACACATCGTTT
BKK10250 (Δ[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATAAATAACATGGTGCTCC,  downstream forward: _UP4_TAAGGCAAAACACATCGTTT
References
Reviews
27074917,38624243
Original Publications
21338420,21338421,31066113

F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D

Page visits: 3227

Time of last update: 2024-06-18 14:33:32

Author of last update: Jstuelk