yxjJ

yxjJ
168

general stress protein, survival of ethanol, paraquat and salt stresses

locus
BSU_38930
Molecular weight
10.42 kDa
pI
8.44
Protein length
Gene length
function
survival of stress conditions
product
unknown
essential
no
ec
null
synonyms
yxjJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,996,829 → 3,997,092
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|P94353]
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]-[gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]
description
[Pubmed|10746760]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]→[gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]

2024-07-03 22:36:47

ghost

57

48fee5453483dfc47b476b333af1285a35e0114a

7B783E5682191A6D5D1B46914DE8A5B62194BA50

Biological materials
Mutant
MGNA-B800 (yxjJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1799 NBRP B. subtilis, Japan]
BKE38930 (Δ[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTGTCCCTCTAAA,  downstream forward: _UP4_TAATTCTATATTTCAAACGA
BKK38930 (Δ[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTGTCCCTCTAAA,  downstream forward: _UP4_TAATTCTATATTTCAAACGA
References
16672620,20525796,15805528,22582280

F4C0A4050414B2FC9D6E571419D9537707DA4C05

Page visits: 3472

Time of last update: 2024-07-13 11:35:20

Author of last update: Melvin.boenninger