meeY

meeY
168

manganese resistance protein

locus
BSU_13440
Molecular weight
35.38 kDa
pI
9.73
Protein length
Gene length
function
resistance to Mn2+ intoxication, co-translocational metalation of Mn2+-dependent membrane and extracellular enzymes
product
manganese resistance protein
essential
no
synonyms
ykoY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0861 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,410,654 → 1,411,628
Phenotypes of a mutant
the [gene|F16A11027D8D320D3D64E44038E29921A946955B|meeF] [gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY] double mutant is defective in [category|SW.3.3.5|Protein secretion] [pubmed|37794032]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
co-translocational metalation of Mn2+-dependent membrane and extracellular enzymes [pubmed|37794032]
Protein family
[wiki|TerC family] [pubmed|37794032]
Structure
[AF|O34997]
Paralogous protein(s)
[protein|F16A11027D8D320D3D64E44038E29921A946955B|meeF]
[wiki|Localization]
cell membrane [pubmed|37794032]
Expression and Regulation
Operons
genes
[gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]-[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]
description
[Pubmed|22383849]
Open in new tab

[gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]→[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]

2024-06-17 00:36:28

Jstuelk

70

0a8ece187c1c4e682fa1a22a3bff4c07244d2fa5

A1FCAE916E61F0364AA6F1BC2A1D2CE08CF38D26

genes
[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]
description
[Pubmed|25794618]
regulation
induced in the presence of Mn2+ ([[yybP-ykoY motif]]) [Pubmed|25794618]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
yybP-ykoY motif: RNA switch, via riboswitch in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|other_regulator:yybP-ykoY motif|yybP-ykoY motif]
Open in new tab

[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]

2024-07-01 17:25:53

Jstuelk

84

00e63dd56c4a67f3c422466ff9fedeed3151cb82

D51E73916925CA156D783D1AC8D489F7018D8DF6

Biological materials
Mutant
MGNA-A780 (ykoY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/780 NBRP B. subtilis, Japan]
BKE13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC,  downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
BKK13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|meeY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC,  downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
References
Reviews
34037759
Original Publications
15096624,25794618,25794619,29794222,31685536,37090602,37794032

F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B

Page visits: 4223

Time of last update: 2024-07-13 21:34:01

Author of last update: Jstuelk