psd

psd
168

phosphatidylserine decarboxylase

locus
BSU_02290
Molecular weight
29.54 kDa
pI
7.27
Protein length
Gene length
function
biosynthesis of phosphatidylethanolamine
product
phosphatidylserine decarboxylase
essential
no
ec
4.1.1.65
synonyms
psd

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0688 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
248,749 → 249,540
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
1,2-diacyl-sn-glycero-3-phospho-L-serine + H+ --> 1,2-diacyl-sn-glycero-3-phosphoethanolamine + CO2 (according to UniProt)
Protein family
phosphatidylserine decarboxylase family (single member, according to UniProt)
Structure
[PDB|6L06] (from E. coli, corresponds to aa 26 ... 208, 29.1% identity) [pubmed|32402247]
[AF|P39822]
[wiki|Localization]
cell membrane at the septum [Pubmed|15743965]
Expression and Regulation
Operons
genes
[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|petA]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
description
[Pubmed|22383849,14762009]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14762009], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]→[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]

2024-07-03 13:08:10

Jstuelk

101

9c5c2fcf642de63f240b8ac199efc5b5939a836b

2A09CF2D25D4B824D045D3A292B8FC9B5A167361

Biological materials
Mutant
BKE02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC,  downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
BKK02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC,  downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
References
14762009,18820022,9422599,15743965,32402247

F34915697F3EF05E6A683055F46346C73F25CAFC

Page visits: 2680

Time of last update: 2024-07-23 06:51:56

Author of last update: Jstuelk