rlmQ

rlmQ
168

23S rRNA methyltransferase, methylates an G in the A-site of the peptidyl transferase center

locus
BSU_38360
Molecular weight
44.28 kDa
pI
9.18
Protein length
Gene length
function
rRNA modification
product
23S rRNA methyltransferase
essential
no
synonyms
ywbD, ipa-19d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1092 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,935,824 → 3,937,014
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
formation of 7-methylguanosine (m7G) at position 2574 of the 23S rRNA [pubmed|38071475]
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
[wiki|Domains]
PUA domain (aa 1-79) (according to UniProt)
Structure
[PDB|3VSE] (from Staphylococcus aureus, 48% identity) [pubmed|23016631]
[AF|P39587]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|rlmQ]
description
[pubmed|22383849]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
Open in new tab

[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|rlmQ]

2024-06-27 09:27:30

Bzhu

51

5131cb21f8d82dbb7973c86d47ac11a401417729

6B17BA667ACF2A3CC648806DD337B723268986BA

Biological materials
Mutant
MGNA-B222 (ywbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1221 NBRP B. subtilis, Japan]
BKE38360 (Δ[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|rlmQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCGTCCTCTTTC,  downstream forward: _UP4_TAAATGAAAAAGCTGCCCTG
BKK38360 (Δ[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|rlmQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCGTCCTCTTTC,  downstream forward: _UP4_TAAATGAAAAAGCTGCCCTG
lacZ fusion
GP1614 ''amyE::p(ywbD-lacZ cat)'', constructed with pGP2150 based on [wiki|pAC5], available in [wiki| Jörg Stülke]'s lab
References
16430695,18786544,23016631,38071475

F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD

Page visits: 2353

Time of last update: 2024-07-14 19:57:08

Author of last update: Jstuelk