lipL

lipL
168

N-amidotransferase, transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH] to [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]

locus
BSU_37640
Molecular weight
31.27 kDa
pI
5.27
Protein length
Gene length
function
lipoic acid metabolism
product
protein N-octanoyltransferase
essential
no
ec
2.3.1.204
synonyms
lipL, ipa-90d, ywfL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0095 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,863,415 → 3,864,260
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC] [pubmed|31066113]
[glycine-cleavage complex H protein]-N6-octanoyl-L-lysine + [lipoyl-carrier protein]-L-lysine --> [glycine-cleavage complex H protein]-L-lysine + [lipoyl-carrier protein]-N6-octanoyl-L-lysine (according to UniProt)
Protein family
Octanoyltransferase LipL family (single member, according to UniProt)
[wiki|Domains]
[wiki|BPL/LPL catalytic domain] (aa 45-253) (according to UniProt)
Structure
[PDB|2P5I] (from ''Bacillus halodurans'', 56% identity)
[AF|P39648]
Expression and Regulation
Operons
genes
[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]
description
[Pubmed|9353933]
Open in new tab

[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]

2024-06-04 20:56:29

ghost

52

10a3670e4f6f6c0b3ee18f18719a356be9eca97c

A03A084AB4C8E07856617B3305361936C9FA31B2

Biological materials
Mutant
MGNA-B667 (ywfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1666 NBRP B. subtilis, Japan]
BKE37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC,  downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
BKK37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC,  downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
References
Reviews
27074917,38624243
Original Publications
9353933,21338420,21338421,31066113

F2E881F4BE0968C75BD75A5EFF4C7CA642034796

Page visits: 2774

Time of last update: 2024-06-20 08:13:28

Author of last update: Jstuelk