epr

epr
168

minor extracellular serine protease, involved in control of swarming motility

locus
BSU_38400
Molecular weight
69.52 kDa
pI
9.88
Protein length
Gene length
function
protein degradation
product
minor extracellular serine protease
essential
no
synonyms
epr, ipa-15r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,939,869 → 3,941,806
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
[wiki|Peptidase S8 domain] (aa 115-382) (according to UniProt)
Structure
[PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|subtilisin], corresponds to aa 27 ... 382, 40% identity) [pubmed|24279884]
[AF|P16396]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]
description
[Pubmed|3142851]
regulation
repressed by [protein|search|SinR] [Pubmed|16923912]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16923912], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|16923912], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, not activated by [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P [Pubmed|19416356], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|11751842], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]

2024-07-06 21:01:41

ghost

72

7c5df77cfd196aa624679370bec1fc693ef83f5d

8CADBA9FC5253DE329D345BC7E9FEC299F136A2B

Biological materials
Mutant
1A1021 ( ''epr''::''tet''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1021&Search=1A1021 BGSC]
KO7 (''ΔnprE  ΔaprE  Δepr  Δmpr  ΔnprB  Δvpr  Δbpr''), available as BGSC 1A1133
BKE38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC,  downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
BKK38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC,  downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
References
Reviews
34410368
Original Publications
16923912,3142851,19416356,18957862,19416356,11751842,23660663,24115457,24279884

F2E3FF41357C672F80012CFE3076F890407B8B4A

Page visits: 4246

Time of last update: 2024-07-15 00:58:17

Author of last update: Jstuelk