panD

panD
168

L-[metabolite|aspartate]-α-decarboxylase

locus
BSU_22410
Molecular weight
13.76 kDa
pI
5.56
Protein length
Gene length
function
biosynthesis of [metabolite|coenzyme A]
product
L-[metabolite|aspartate]-α-decarboxylase
essential
no
ec
4.1.1.11
synonyms
panD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0853 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,352,592 → 2,352,975
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
the mutant cells are thinner and shorter than wild type cells [pubmed|34846166]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
H+ + L-[metabolite|aspartate] --> [metabolite|beta-alanine] + CO2 [pubmed|36341775]
Protein family
PanD family (single member, according to UniProt)
Structure
[PDB|2C45] (from ''Mycobacterium tuberculosis'', 54% identity) [Pubmed|17001646]
[AF|P52999]
Modification
autocleavage between Gly-24 and Ser-25 to yield the active pyruvyl cofactor that catalyzes decarboxylation [pubmed|30073608]
Expression and Regulation
Operons
genes
[gene|A0001681244113B808757281C1B70C0C94F28A27|panB]-[gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]-[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]-[gene|03BFD8AD2E3D95858752F46366F6C2028D709029|dinG]-[gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]-[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
description
[Pubmed|22383849]
Open in new tab

[gene|A0001681244113B808757281C1B70C0C94F28A27|panB]→[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]

2024-06-20 11:07:37

Jstuelk

51

3C14CF916926052D4B293230C8985ACC791FC72B

3C14CF916926052D4B293230C8985ACC791FC72B

additional information
formed as an inactive pre-protein, autocleavage between Gly-24 and Her-25 yields the active pyruvyl cofactor that catalyzes decarboxylation [pubmed|30073608]
Biological materials
Mutant
BKE22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT,  downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
BKK22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT,  downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
GP3337 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::cat trpC2), available in [wiki|Jörg Stülke]'s lab
GP3399 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::neo trpC2), available in [wiki|Jörg Stülke]'s lab
Expression vectors
pGP3725: expression of ''panD'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
References
17001646,28589224,26762040,32096553,34837493,34846166,35447535,36341775,30073608

EE712C1EC9E9C371847C83F7D75C189B276CD4B6

Page visits: 9158

Time of last update: 2024-06-19 13:06:38

Author of last update: Jstuelk