glpT

glpT
168

[metabolite|glycerol-3-phosphate] permease

locus
BSU_02140
Molecular weight
49.64 kDa
pI
9.37
Protein length
Gene length
function
[metabolite|glycerol-3-phosphate] uptake
product
glycerol-3-phosphate permease
essential
no
synonyms
glpT, ybeE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
233,994 → 235,328
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
uptake of [metabolite|glycerol-3-phosphate]
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[PDB|1PW4] (from E. coli, 60% identity) [pubmed|12893936]
[AF|P37948]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
description
[Pubmed|8012593]
regulation
induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
regulatory mechanism
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, via a protein-dependent [wiki|RNA switch] [Pubmed|8012593], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|10913081], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8012593], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]→[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

2024-07-03 11:40:48

ghost

51

e21fcae2eb545caac4a51ee013af601bc96688aa

3E9AB6EA1D92E82B84D67092560AC5EC28AD9E48

additional information
increased expression at increased temperature (via an RNA thermometer that covers the Ribosomal binding site of the mRNA) [pubmed|37217261]
Biological materials
Mutant
QB5437 (ermC), available in the [wiki|Stülke] lab
BKE02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT,  downstream forward: _UP4_TAAGAAAGACACATAAAAGA
BKK02140 (Δ[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATAATTATCCCCCTT,  downstream forward: _UP4_TAAGAAAGACACATAAAAGA
References
8012593,12850135,12893936,37217261

ECCBD8EF461C24D693450E10EC268DBC7A440618

Page visits: 3777

Time of last update: 2024-07-14 22:30:04

Author of last update: Jstuelk