ilvC

ilvC
168

ketol-acid reductoisomerase (2,3-dihydroxy-3-methylbutanoate, [metabolite|2-acetolactate], [metabolite|alpha-ketopantoate])

locus
BSU_28290
Molecular weight
37.30 kDa
pI
5.37
Protein length
Gene length
function
biosynthesis of branched-chain amino acids and [metabolite|coenzyme A]
product
ketol-acid reductoisomerase (2,3-dihydroxy-3-methylbutanoate, [metabolite|2-acetolactate], [metabolite|alpha-ketopantoate])
essential
no
ec
1.1.1.86
synonyms
ilvC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0059 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,893,681 2,894,709
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(2R)-2,3-dihydroxy-3-methylbutanoate + [metabolite|NADP]+ --> (2S)-[metabolite|2-acetolactate] + H+ + [metabolite|NADPH] (according to UniProt)
(2R,3R)-2,3-dihydroxy-3-methylpentanoate + [metabolite|NADP]+ --> (S)-2-ethyl-2-hydroxy-3-oxobutanoate + H+ + [metabolite|NADPH] (according to UniProt)
ketopantoate]] + H+ + [metabolite|NADPH] --> (R)-[metabolite|pantoate] + [metabolite|NADP]+ [https://www.biorxiv.org/content/10.1101/2024.04.17.589903v1.full.pdf bioRxiv]
Protein family
ketol-acid reductoisomerase family (single member, according to UniProt)
[wiki|Domains]
N-terminal Rossmann domain (aa 2-181) (according to UniProt)
C-terminal knotted domain (aa 182-327) (according to UniProt)
Structure
[PDB|1NP3] (from ''Escherichia coli'', 53% identity, 71% similarity) [Pubmed|12691757]
[AF|P37253]
Modification
phosphorylated on Arg-298 [Pubmed|22517742]
phosphorylated on Ser-338 [Pubmed|20509597]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
description
[Pubmed|1577690]
regulation
expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [PubMed|12193635]
regulatory mechanism
T-box: RNA switch, via tRNA controlled [wiki|RNA switch], repression by BCAA, in [regulon|other_regulator:T-box|T-box]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|15547269], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|12193635], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1577690], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]→[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]

2024-06-16 08:10:45

Jstuelk

101

905a0fc4b9e1945f65cf0820ea8bda45e4ac716c

931C13BE07545B8037A118810CF4C8E29210A7CE

Biological materials
Mutant
BKE28290 ([gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCTCTCCCTTGT, downstream forward: _UP4_AAGAAGAAGGAAGCGGTGGT
BKK28290 ([gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCTCTCCCTTGT, downstream forward: _UP4_AAGAAGAAGGAAGCGGTGGT
GP3342 (''[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]''::lox72), available in [wiki|Jörg Stülke]'s lab
GP4404 (''[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]''::neo), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP521 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab
References
24163341,15060025,12193635,19258532,8289305,18641142,20935095,15547269,12618455,12107147,20509597,22517742,15378759,25755103,25157083,26220295,28516784

EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57

Page visits: 5070

Time of last update: 2024-06-20 16:16:33

Author of last update: Jstuelk