rpmH

rpmH
168

ribosomal protein bL34

locus
BSU_41060
Molecular weight
5.00 kDa
pI
13
Protein length
Gene length
function
translation
product
ribosomal protein L34 (bL34)
essential
no
synonyms
rpmH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0230 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,215,255 → 4,215,389
Phenotypes of a mutant
severe slow-growth phenotype, suppressed by disruption of ''[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]'' or overexpression of ''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE]'' [Pubmed|25182490]
increased fraction of hyperpolarized cells (35.2% vs. 3.7% in the wild type) [pubmed|30853217]
the [wiki|ribosome]s are destabilized [pubmed|25182490]
severely impaired for growth in the presence of 1.2 M NaCl [pubmed|35164567]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
required for efficient 70S-[wiki|ribosome] formation [Pubmed|25182490]
Protein family
bacterial [wiki|ribosomal protein] bL34 family (single member, according to UniProt)
Structure
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
[AF|P05647]
[wiki|Localization]
[wiki|ribosome]
Additional information
this ribosomal protein is lacking in some bacteria [pubmed|33753464]
Expression and Regulation
Operons
genes
[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]
description
[Pubmed|2987847]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2987848], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]

2024-07-02 17:50:52

ghost

67

642ba612d8e1e367b1bb3918ce2fbe08dd7bdebd

0126CA9BBEC4943DE22E0E8C647D1BFB28D4BCC3

genes
[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]-[gene|594F2D36BE71A45303A33AA2A2931F56F0A969ED|rnpA]-[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1]-[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]
description
[Pubmed|22383849]
regulation
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Open in new tab

[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]→[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]

2024-07-09 10:12:14

Jstuelk

111

E083541B5FC7B773C237692E19D8D077A360C15A

091CC69B9E971C4FEAD3C4AEC4A1CDFAE7D6AF75

Biological materials
Mutant
BKK41060 (Δ[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK41060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATGACACCTCCCTCG,  downstream forward: _UP4_TAGGCCACTGAATAATGTCA
References
19653700,2987847,2987848,20525796,23002217,25182490,25903689,30853217,33753464,33782055,35164567

EB07AECD3849CC0B65126DE27E71B28B3AD106B0

Page visits: 4702

Time of last update: 2024-07-14 17:02:06

Author of last update: Jstuelk