ycbK

ycbK
168

similar to efflux system

locus
BSU_02540
Molecular weight
33.81 kDa
pI
9.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycbK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
277,342 → 278,280
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
[wiki|EamA domain] (aa 173-303) (according to UniProt)
Structure
[AF|P42243]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]-[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]
description
[Pubmed|10706627]
regulation
''[protein|search|rtpA]'': induced by tryptophan limitation ([protein|search|T-box] in the mRNA leader) [Pubmed|10706627]
regulatory mechanism
T-box: RNA switch, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] [pubmed|10706627], in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10706627], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]→[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]

2024-07-14 10:06:24

ghost

87

aba3d4c421cab4fd6a7de94322e269e3fab0812f

2561988BA77F538C12BE51ECE1598FD4932FFB98

Other regulations
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: translation inhibition
Biological materials
Mutant
MGNA-C033 (ycbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2031 NBRP B. subtilis, Japan]
BKE02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT,  downstream forward: _UP4_TAATTTTTATAAAACACACA
BKK02540 (Δ[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAGCTCAGCTTTTCT,  downstream forward: _UP4_TAATTTTTATAAAACACACA
References
19258532,10706627,16879415

EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5

Page visits: 2018

Time of last update: 2024-07-15 07:46:12

Author of last update: Melvin.boenninger