spoVG

spoVG
168

RNA-binding regulatory protein, negative effector of asymetric septation at the onset of sporulation

locus
BSU_00490
Molecular weight
10.75 kDa
pI
5.11
Protein length
Gene length
function
cell division, control of sporulation initiation
product
negative effector of asymetric septation
essential
no
synonyms
spoVG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2088 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
55,866 → 56,159
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
SpoVG family (single member, according to UniProt)
Structure
[PDB|2IA9]
[AF|P28015]
Modification
phosphorylation on (Ser-66 OR Ser-67 OR Thr-68) [Pubmed|17218307]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
Expression and Regulation
Operons
genes
[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]
description
[Pubmed|408013]
regulation
repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] [Pubmed|16430695]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|2437099], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|408013], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]

2024-07-13 16:01:13

Bzhu

80

c719c84373323a88ade62cefff7d91aa9314b417

69861A233BD88B17BF35EBBCA8A937C5FFEA3064

Biological materials
Mutant
MGNA-A082 (spoVG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/82 NBRP B. subtilis, Japan]
GP2109 (''[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]''::''tet'', available in [wiki|Jörg Stülke]'s lab)
BKE00490 (Δ[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTAGTTCACCACCTTT,  downstream forward: _UP4_TAAAAAATAACCAAAAAGCA
BKK00490 (Δ[gene|E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775|spoVG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTAGTTCACCACCTTT,  downstream forward: _UP4_TAAAAAATAACCAAAAAGCA
Expression vectors
pGP2163: expression of SpoVG-Strep by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2310: expression of SpoVG-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Reviews
33690958,35638784
Original Publications
408013,1850083,16430695,6405278,6411929,10348850,7559352,8419299,3100810,2437099,17218307,20803133,27048798,34102998

E9FF83FA90DCD7ECABFD67E95ECFAD3518DDC775

Page visits: 8045

Time of last update: 2024-07-15 07:42:55

Author of last update: Jstuelk