glpQ

glpQ
168

glycerolphosphate diester phosphodiesterase, degrades wall teichoic acid during phosphate starvation

locus
BSU_02130
Molecular weight
32.81 kDa
pI
9.26
Protein length
Gene length
function
[metabolite|glycerol-3-phosphate] utilization, degradation of wall teichoic acid during phosphate starvation
product
glycerolphosphate diester phosphodiesterase
essential
no
ec
3.1.4.46
synonyms
glpQ, ybeD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0584 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
233,014 → 233,895
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
exohydrolytic activity on wall teichoic acid, acts in concert with [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD] [Pubmed|27780866]
removes glycerolphosphates from the free end of the unsubstituted wall teichoic acid up to the peptidoglycan linker [pubmed|32047114]
sn-glycero-3-phosphoester + H2O --> alcohol + H+ + sn-glycerol 3-phosphate (according to UniProt)
Protein family
glycerophosphoryl diester phosphodiesterase family (with [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW], according to UniProt)
[wiki|Domains]
GP-PDE domain (aa 38-290) (according to UniProt)
Structure
[PDB|5T9B] [Pubmed|27780866]
[AF|P37965]
Paralogous protein(s)
[protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW], [protein|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
description
[Pubmed|8012593]
regulation
induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
regulatory mechanism
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, via a protein-dependent [wiki|RNA switch] [Pubmed|8012593], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|10913081], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8012593], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]→[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

2024-07-03 11:40:48

ghost

51

e21fcae2eb545caac4a51ee013af601bc96688aa

3E9AB6EA1D92E82B84D67092560AC5EC28AD9E48

genes
[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
regulation
induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
Open in new tab

[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

2024-07-15 01:15:59

ghost

59

f9519a8adc13cc4efc98d0b5009f78016069c36e

D97DEF600BA4CCBF43E0FE575AF9B2A0A8935AA5

Biological materials
Mutant
BKE02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA,  downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
BKK02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA,  downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
References
Reviews
24373430,38491249
Original Publications
8012593,10913081,18214974,18957862,27780866,32047114

E9BEF368F8E55888AD4849E8906E517831A882DF

Page visits: 3689

Time of last update: 2024-07-14 10:44:14

Author of last update: Jstuelk