pdhD

pdhD
168

dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes

locus
BSU_14610
Molecular weight
49.57 kDa
pI
4.76
Protein length
Gene length
function
links glycolysis and TCA cycle, enzyme in TCA cycle
product
dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes
essential
no
ec
1.8.1.4
synonyms
pdhD, citL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1249 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,531,870 1,533,282
Phenotypes of a mutant
defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Protein N6-(dihydrolipoyl)lysine + NAD+ --> protein N6-(lipoyl)lysine + NADH2 (according to UniProt)
Protein family
class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV], according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, Geobacillus stearothermophilus), [PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, ''Geobacillus stearothermophilus'')
[AF|P21880]
Modification
phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]
Effectors of protein activity
Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
Low sensibility to NADPH [Pubmed|6414463]
Kinetic information
Michaelis-Menten [Pubmed|6414463]
Paralogous protein(s)
[protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV], [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
[wiki|Localization]
cytoplasm (according to UniProt)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]-[gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]-[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20081037], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2024-05-22 00:31:42

ghost

74

797fea7dcbe4317f63eb94d44165272d12ff3ae4

3D5EA61F84C1F6538A394D4F9A00FD4029ED115F

genes
[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
Open in new tab

[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2024-05-21 21:54:32

ghost

72

22b57c718f31ad11fe44c3a9b66c0348a0c6dcab

F1C43D78FC4D596937F2D6B16CB47827D858EE6D

Biological materials
Mutant
BKE14610 ([gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA
BKK14610 ([gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
FLAG-tag construct
GP1427 (spc, based on [wiki|pGP1331]), available in the [wiki|Jrg Stlke]'s lab
lacZ fusion
pGP723 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab
References
Reviews
19476487,9655937,2227213,6805383,10672230,24798336
Original Publications
12850135,6414463,11976308,17726680,20081037,20933603,24204596,15378759,36815589,

E9BBAE86DF3E536A987179CC394B472F6F710498

Page visits: 7359

Time of last update: 2024-05-23 06:42:53

Author of last update: Jstuelk