bmrB

bmrB
168

regulatory leader peptide for the control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression

locus
BSU_09700
Molecular weight
6.18 kDa
pI
11.08
Protein length
Gene length
function
control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
product
leader peptide
essential
no
synonyms
bmrB, yheJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,045,037 → 1,045,198
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[AF|O07551]
Expression and Regulation
Operons
genes
[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|E98074149254BF56648F6CBE56E74B3D7DCD5DB3|bmrX]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]
description
[Pubmed|25217586]
regulation
[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|E98074149254BF56648F6CBE56E74B3D7DCD5DB3|bmrX]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression only occurs during the late-exponential and stationary growth stages ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]) [Pubmed|25217586]
RNA processing in the intergenic region between [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC] and [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC] (in [gene|E98074149254BF56648F6CBE56E74B3D7DCD5DB3|bmrX]) ([protein|search|Rae1]) [pubmed|37142436]
expression
expression is increased upon depletion of depletion of tRNA maturation factors [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB] or [gene|C40C5D35ED53D343C8200248FCCB010BAB388054|rnz] [pubmed|36840557]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,25217586], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]: attenuation, [Pubmed|25217586], in [regulon|protein:E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB regulon]
Open in new tab

[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]→[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]

2024-07-06 17:10:24

Jstuelk

110

5133AE29C8DE1B1184B38190144E212977A8B571

6093E35E651F3CE8574990742E33F0A5554BD884

Biological materials
Mutant
MGNA-A706 (yheJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/706 NBRP B. subtilis, Japan]
BKE09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
BKK09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
References
20817675,25217586,36840557,37142436

E9956A958C66C4114EB974EA6F9BF30CD951034A

Page visits: 4119

Time of last update: 2024-07-18 23:36:21

Author of last update: Jstuelk