pyrD

pyrD
168

dihydroorotic acid dehydrogenase (catalytic subunit)

locus
BSU_15540
Molecular weight
32.94 kDa
pI
4.94
Protein length
Gene length
function
pyrimidine biosynthesis
product
dihydroorotic acid dehydrogenase (catalytic subunit)
essential
no
ec
1.3.3.1
synonyms
pyrD, pyrDI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0167 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,627,718 → 1,628,653
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(S)-dihydroorotate + NAD+ --> H+ + NADH + orotate (according to UniProt)
Protein family
dihydroorotate dehydrogenase family (single member, according to UniProt)
[wiki|Cofactors]
FMN [pubmed|11188687]
Structure
[PDB|1EP1] (from ''Lactococcus lactis'', 68% identity) [Pubmed|11188687]
[AF|P25996]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2024-06-18 17:36:24

ghost

90

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

Biological materials
Mutant
1A806 ( ''pyrD''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A806&Search=1A806 BGSC]
1A807 ( ''pyrD''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A807&Search=1A807 BGSC]
BKE15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA,  downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
BKK15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA,  downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
References
8206849,1709162,10545205,11188687

E533BEF28579CD04B24E2C728737269E35224450

Page visits: 3564

Time of last update: 2024-07-14 21:07:16

Author of last update: Melvin.boenninger