atpA

atpA
168

ATP synthase, part of the F1 complex (subunit alpha)

locus
BSU_36830
Molecular weight
54.43 kDa
pI
5.04
Protein length
Gene length
function
ATP synthesis
product
ATP synthase (subunit alpha)
essential
no
ec
3.6.3.14
synonyms
atpA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0056 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,783,878 3,785,386
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
ATP + 4 H+ + H2O --> ADP + 5 H+ + phosphate (according to UniProt) [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
Protein family
ATPase alpha/beta chains family (with [protein|401459F105BC8A8342341D953AE259D6C3868AB6|fliI] and [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD], according to UniProt)
Structure
[PDB|1SKY] ([protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD] complex from ''Bacillus sp.'', 88% identity) [Pubmed|9261073]
[PDB|see here an overview on ATPase structure]
[AF|P37808]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Effectors of protein activity
ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD] [pubmed|30580998]
[wiki|Localization]
membrane [Pubmed|18763711]
peripheral via theF0 complex
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
description
[Pubmed|9353933]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]→[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]

2024-05-13 06:23:48

Jstuelk

90

c30b9914547f38015d481b305686327f4f8f18d8

1C7DF7F5F812B06EFE55424A9900C106B30D346A

Biological materials
Mutant
BKE36830 ([gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
BKK36830 ([gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
References
Reviews
23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
Research papers
30580998
Original Publications
36815589,7961438,15378759,16493705,18763711,25244289,9261073,26883633

E3FADE979CE6AB6315F67812608FCE00CF4E2453

Page visits: 5231

Time of last update: 2024-05-21 17:52:32

Author of last update: Jstuelk