

5-methylthioribose kinase

Molecular weight
45.19 kDa
Protein length
Gene length
methionine salvage
5-methylthioribose kinase
mtnK, ykrT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4857 (Galperin et al., 2021)

This gene is a member of the following regulons

1,423,241 1,424,440
Visit Visit
The protein
Catalyzed reaction/ biological activity
ATP + S-methyl-5-thio-D-ribose --> ADP + H+ + S-methyl-5-thio--D-ribose 1-phosphate (according to UniProt)
Protein family
methylthioribose kinase family (single member, according to UniProt)
phosphorylated on Arg-80 OR Arg-82 and Arg-365 [Pubmed|22517742]
membrane associated [Pubmed|18763711]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-19 05:28:26





Biological materials
MGNA-A783 (ykrT::erm), available at the [ NBRP B. subtilis, Japan]
BKE13560 ([gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAATTATGTAA, downstream forward: _UP4_TGATCTATTCATGACCCATT
BKK13560 ([gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAATTATGTAA, downstream forward: _UP4_TGATCTATTCATGACCCATT


Page visits: 3900

Time of last update: 2024-06-19 11:21:38

Author of last update: Jstuelk