citB

citB
168

aconitase, trigger enzyme

locus
BSU_18000
Molecular weight
99.14 kDa
pI
4.9
Protein length
Gene length
function
TCA cycle
product
aconitase, trigger enzyme
essential
no
ec
4.2.1.3
synonyms
citB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1048 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,926,680 1,929,409
Phenotypes of a mutant
glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Citrate --> isocitrate (according to UniProt)
3-hydroxybutane-1,2,3-tricarboxylate --> 2-methyl-cis-aconitate + H2O (according to UniProt)
Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]
2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599]
Protein family
aconitase/IPM isomerase family (with [protein|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC], according to UniProt)
[wiki|Cofactors]
FeS cluster [pubmed|29292548]
Structure
[PDB|2B3X] (the human enzyme, 53% identity) [pubmed|16407072]
[AF|P09339]
Additional information
B. subtilis aconitase is both an enzyme and an RNA binding protein ([wiki|moonlighting protein]) [PubMed|10468622]
extensive information on the structure and enzymatic properties of CitB can be found at [https://proteopedia.org/wiki/index.php/Aconitase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
description
[Pubmed|22383849]
regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12591885], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1310745], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]→[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]

2024-05-21 20:21:54

ghost

113

11c3575e19719d9d98495e9324e23aee6d346029

4D8AE4853A402B931A1A3D2C11A2983642117BB6

Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]: translation repression, [Pubmed|18697947]
Biological materials
Mutant
GP1275 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm), available in [wiki|Jörg Stülke]'s lab
GP1441 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::spec), available in [wiki|Jörg Stülke]'s lab
1A999 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::spec), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
GP2338 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan, Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]), available in [wiki|Jörg Stülke]'s lab
GP2339 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::lox72, Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]), available in [wiki| Jörg Stülke]'s lab
BKE18000 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
BKK18000 ([gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
Expression vectors
pFM1, expression of [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB] with a cleavable His6-tag at the C-terminus in E. coli, based on pBAD30, available in [wiki|Jörg Stülke]'s lab [pubmed|23354745]
pGP939, expression in E. coli, based on pBluescript, available in [wiki|Jörg Stülke]'s lab
pGP1810, expression of Strep-[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB] in E. coli, based on [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1144 [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-3xFLAG spc (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
GP1145 [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-3xFLAG kan, available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP700 (cat, based on [wiki|pAC5]]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Linc Sonenshein]'s lab
GFP fusion
GP1434 (spc, based on [wiki|pGP1870]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
12732309,2696478,18261896,18086213,32850966
Original Publications
36815589,18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599,16407072

E15E9F88B0E03FE8834C646369D2F4B4E713EF41

Page visits: 9119

Time of last update: 2024-05-23 11:34:57

Author of last update: Jstuelk