

flagellin protein, about 12,000 subunits make up one flagellum

Molecular weight
32.47 kDa
Protein length
Gene length
[wiki|motility and chemotaxis]
flagellin protein

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1344 (Galperin et al., 2021)

This gene is a member of the following regulons

3,634,987 3,635,901
Phenotypes of a mutant
increased [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P formation, resulting in reduced [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] expression and strongly reduced [wiki|genetic competence] [pubmed|28800172]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827,19202088]
not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
few hours delay in pellicle development [Pubmed|26122431]
mutant has increased fitness in planktonic culture when competed with the wild-type NCIB3610 strain [Pubmed|26122431]
a substitution of Ala233 to Val results in straight flagella [pubmed|28800172]
additional information
the [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] gene is often inactivated during adaptation to plants [pubmed|37466402]
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
bacterial flagellin family (with [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL] and [protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|yvzB], according to UniProt)
[PDB|3A5X] (from ''Salmonella typhimurium'', 42% identity) [pubmed|20228803]
the structure of flagellar filaments: [pubmed|29038601]
Paralogous protein(s)
[protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|yvzB], (C-terminal domain)
extracellular (no signal peptide), major component of the secretome [Pubmed|18957862]
membrane [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
12.000 monomers make up one flagellum [pubmed|31113895]
Expression and Regulation
repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12730172]
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12730172], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19118355], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|2498284], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab


2024-05-22 02:31:47





Other regulations
[protein|93F328524989597C7D2329B25E665496C9631E87|csrA]: translation inhibition, [Pubmed|17555441]
Biological materials
GP901 (aphA3), GP902 (tet) [Pubmed|21856853], both available in [wiki|Jrg Stlke]'s lab
1A915 ( ''hag''::''cat''), [Pubmed|19202088], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A915&Search=1A915 BGSC]
1A783 ( ''hag''::''erm''), [Pubmed|2174860], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A783&Search=1A783 BGSC]
1A842 ( ''hag''::''kan''), [Pubmed|14762011], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A842&Search=1A842 BGSC]
DS1677 (marker-less in NCIB3610) [Pubmed|18566286]
BKE35360 ([gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
BKK35360 ([gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
Expression vectors
expression in ''B. subtilis'', in [wiki|pBQ200]: pGP1089, available in [wiki|Jrg Stlke]'s lab
lacZ fusion
pGP1035 (in [wiki|pAC6]), pGP755 (in [wiki|pAC7]), there is also a series of promoter deletion variants in [wiki|pAC6] and [wiki|pAC7] [Pubmed|21856853], all available in [wiki|Jrg Stlke]'s lab
GFP fusion
BP494 (bglS:: (hag-promoter-cfp-aphA3)), BP496 (amyE:: (hag-promoter-iyfp-cat)), available in [wiki|Jrg Stlke]'s lab
[wiki|Daniel Kearns]
Original Publications


Page visits: 8306

Time of last update: 2024-05-23 10:45:56

Author of last update: Jstuelk