

tryptophan operon RNA-binding attenuation protein (TRAP), controls RNA switch in front of genes involved in biosynthesis and acquisition of tryptophan

Molecular weight
8.19 kDa
Protein length
Gene length
regulation of tryptophan biosynthesis(and translation) attenuation in the trp operon;repression of the folate operon
tryptophan operon RNA-binding attenuation protein (TRAP)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

2,384,534 → 2,384,761
Visit Visit
The protein
Protein family
MtrB family (single member, according to UniProt)
[PDB|3AQD],  [PDB|1WAP] (complex with L-tryptophan), [PDB|2ZP9] (complex with [protein|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA])
Effectors of protein activity
binding of tryptophan results RNA binding and thus in transcription termination
Expression and Regulation
constitutive [Pubmed|19767425]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2123343], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-15 20:10:46





Biological materials
BKE22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC,  downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
BKK22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC,  downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
Original Publications


Page visits: 3981

Time of last update: 2024-07-15 08:43:16

Author of last update: Jstuelk