

protein kinase D

Molecular weight
29.91 kDa
Protein length
Gene length
protein kinase D
prkD, ybdM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0515 (Galperin et al., 2021)

This gene is a member of the following regulons

223,219 → 223,989
Visit Visit
The protein
Catalyzed reaction/ biological activity
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
phosphorylates [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS] on Ser-76 (in vitro) [Pubmed|21304896]
Protein family
[wiki|protein kinase superfamily] (according to UniProt)
[wiki|Ser/Thr protein kinase family] (according to UniProt)
[wiki|Protein kinase domain] (aa 25-256) (according to UniProt)
[PDB|4EQM] (PknB from Staphylococcus aureus, 34% identity in the N-terminal part, aa 18 ... 174) [pubmed|22701750]
autophosphorylated on Thr-174 (''in vitro'')  [Pubmed|20389117]
Biological materials
MGNA-B958 (ybdM::erm), available at the [ NBRP B. subtilis, Japan]
GP578 (aphA3), available in  [wiki|Jörg Stülke]'s lab
BKE02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG,  downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
BKK02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG,  downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
Expression vectors
pGP390 (N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP380]), available in [wiki|Jörg Stülke]'s lab
for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP821,  available in [wiki|Jörg Stülke]'s lab, [pubmed|20389117]
for expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP1407,  available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP830 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab


Page visits: 5173

Time of last update: 2024-05-25 04:31:30

Author of last update: Melvin.boenninger