

similar to patatin-like phospholipase

Molecular weight
28.11 kDa
Protein length
Gene length
putative phospholipase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1752 (Galperin et al., 2021)

This gene is a member of the following regulons

1,571,981 → 1,572,763
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
NTE family (single member, according to UniProt)
PNPLA domain (aa 8-166) (according to UniProt)
[PDB|5FYA] (from Pseudomonas aeruginosa, 35% identity) [pubmed|27012424]
Expression and Regulation
Open in new tab


2024-07-11 16:55:58





Biological materials
MGNA-B247 (ylbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1246 NBRP B. subtilis, Japan]
BKE15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC,  downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
BKK15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC,  downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC


Page visits: 1251

Time of last update: 2024-07-14 20:28:25

Author of last update: Melvin.boenninger