ung

ung
168

[metabolite|uracil]-DNA glycosylase

locus
BSU_37970
Molecular weight
25.90 kDa
pI
8.78
Protein length
Gene length
function
DNA repair
product
[metabolite|uracil]-DNA glycosylase
essential
no
synonyms
ung, ipa-57d, ywdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0692 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,897,685 → 3,898,362
Phenotypes of a mutant
increased mutation rates [Pubmed|22056936]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
removes [metabolite|uracil] preferentially from single-stranded DNA over double-stranded DNA, exhibiting higher preference for U:G than U:A mismatches [Pubmed|21542855]
Protein family
[metabolite|uracil]-DNA glycosylase (UDG) superfamily (single member, according to UniProt)
Structure
[PDB|3A7N] (from ''Mycobacterium tuberculosis'', 42% identity) [Pubmed|20693660]
[AF|P39615]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]
description
[Pubmed|9353933]
regulation
expressed throughout growth and staionary phase [Pubmed|22056936]
Open in new tab

[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]

2024-05-21 05:47:58

ghost

71

fac25365a9214f8c530abd9dea93947ed89ac925

2C26D36E102505858B4708A4BC37F1769EC0CFCA

genes
[gene|1DA87B205F2E201DE027209620110D043AF8A6AF|ywdF]-[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]
description
[Pubmed|22383849]
Open in new tab

[gene|1DA87B205F2E201DE027209620110D043AF8A6AF|ywdF]→[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]

2024-06-11 16:33:09

Jstuelk

56

5cf885102714c9a598bee66fc7cb76689422527d

81E81ED183B4658297E0325FE66140398B5EED5E

Biological materials
Mutant
BKE37970 (Δ[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCTGTTTCAAGATTCAGG,  downstream forward: _UP4_TAAAAAGCGCAGGTGATCTG
BKK37970 (Δ[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAGCTGTTTCAAGATTCAGG,  downstream forward: _UP4_TAAAAAGCGCAGGTGATCTG
References
Reviews
22933559,38551349
Original Publications
9353933,20693660,22056936,21170359,21542855,25326311,27530626

DC73C11C3C54D35B2D9A0A28666A29E36451E7F8

Page visits: 1417

Time of last update: 2024-06-20 01:24:11

Author of last update: Jstuelk