

similar to glycosyltransferase

Molecular weight
42.46 kDa
Protein length
Gene length
[wiki|biofilm formation]
epsF, yveP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0438 (Galperin et al., 2021)

This gene is a member of the following regulons

3,523,270 → 3,524,424
Visit Sartorius.com Visit Sartorius.com
The EAR [wiki|RNA switch]
The protein
Protein family
[wiki|glycosyltransferase 1 family] (according to UniProt)
[wiki|Glycosyltransferase 4 subfamily] (according to UniProt)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A069 (yveP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/69 NBRP B. subtilis, Japan]
BKE34320 (Δ[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACATGGAGCACGCGCTTTT,  downstream forward: _UP4_AGCACGGAAAAGGACCATAA
BKK34320 (Δ[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AACATGGAGCACGCGCTTTT,  downstream forward: _UP4_AGCACGGAAAAGGACCATAA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]


Page visits: 3086

Time of last update: 2024-07-14 03:29:28

Author of last update: Melvin.boenninger