gcvPA

gcvPA
168

glycine decarboxylase (subunit 1)

locus
BSU_24560
Molecular weight
49.33 kDa
pI
6.95
Protein length
Gene length
function
glycine utilization
product
glycine decarboxylase (subunit 1)
essential
no
ec
1.4.4.2
synonyms
gcvPA, yqhJ, gcvP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0403 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,546,869 → 2,548,215
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
glycine + H+ + N6-lipoyl-L-lysyl-[glycine-cleavage complex H protein] --> (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[glycine-cleavage complex H protein] + CO2 (according to UniProt)
Protein family
GcvP family (with [protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB], according to UniProt)
Structure
[PDB|1WYT] (the [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB] complex from Thermus thermophilus, 56% identity) [pubmed|15791207]
[AF|P54376]
Expression and Regulation
Operons
genes
[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
description
[Pubmed|15472076]
regulation
induced by glycine [Pubmed|15472076]
the [wiki|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
Gly-box: RNA switch, [pubmed|31992591], in [regulon|other_regulator:Gly-box|Gly-box]
Open in new tab

[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]→[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]

2024-06-03 08:29:46

Jstuelk

55

b8399a8069749ebce96a5673beef55862123ad69

18A61526FCBD278A97D718FA1F476B3A75682C1F

Biological materials
Mutant
MGNA-C415 (yqhJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2413 NBRP B. subtilis, Japan]
BKE24560 (Δ[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTGTCTCCTCTCTC,  downstream forward: _UP4_CTCATTCAGGAATTGGGGGA
BKK24560 (Δ[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTGTCTCCTCTCTC,  downstream forward: _UP4_CTCATTCAGGAATTGGGGGA
References
12107147,15472076,15791207

DB0618EBA12013842ED3972165D0276F438D8EC1

Page visits: 1751

Time of last update: 2024-06-12 06:13:30

Author of last update: Melvin.boenninger