ackA

ackA
168

acetate kinase

locus
BSU_29470
Molecular weight
42.98 kDa
pI
5.19
Protein length
Gene length
function
overflow metabolism
product
acetate kinase
essential
no
ec
2.7.2.1
synonyms
ackA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0282 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,015,111 3,016,298
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
acetate + ATP --> acetyl phosphate + ADP (according to UniProt)
Protein family
acetokinase family (with [protein|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk], according to UniProt)
Structure
[PDB|2IIR] (from ''Thermotoga maritima'', 54% identity, 73% similarity)
[AF|P37877]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]
description
[Pubmed|8226682]
regulation
activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|16995897]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|16995897], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|8226682,12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8226682], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]

2024-05-23 07:00:48

ghost

76

dd206a197661afbecfae8fedfc7263549fe2c0ff

2A1BE4F157042B98F7609BFE76D2AD0293E31FBB

Biological materials
Mutant
GP1902 (''ackA''::''aphA3'') (available in [wiki|Jrg Stlke]'s lab)
BKE29470 ([gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
BKK29470 ([gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
References
Reviews
16678422,15755952
Original Publications
8226682,9811655,15378759,11244084,16995897,12850135,8226682,9811655,21106498,26098117,36815589

DAA285C86692E8B47D48652E0973AE3FF091CBC3

Page visits: 6286

Time of last update: 2024-05-23 08:08:42

Author of last update: Jstuelk