sucC

sucC
168

succinyl-CoA synthetase (beta subunit)

locus
BSU_16090
Molecular weight
41.21 kDa
pI
4.85
Protein length
Gene length
function
TCA cycle
product
succinyl-CoA synthetase (beta subunit)
essential
no
ec
6.2.1.5
synonyms
sucC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0045 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,680,431 1,681,588
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
ATP + CoA + succinate --> ADP + phosphate + succinyl-CoA (according to UniProt)
Protein family
succinate/malate CoA ligase beta subunit family (single member, according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp domain] (aa 9-244) (according to UniProt)
Structure
[PDB|1JKJ] (E. coli)
[AF|P80886]
Modification
phosphorylation on Ser-220 [Pubmed|17218307]
Effectors of protein activity
Inhibited by 2-oxoglutarate, ATP and NADH [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-44C8RWC-SH&_user=5731894&_coverDate=01/01/1985&_rdoc=28&_fmt=high&_orig=browse&_srch=doc-info(#toc#4938#1985#998209998#270526#FLP#display#Volume)&_cdi=4938&_sort=d&_docanchor=&_ct=40&_acct=C000043105&_version=1&_urlVersion=0&_userid=5731894&md5=f14f4734123ab1177d7217cab6c7ce7d FEBS Letters]
GTP is not accepted by the enzyme [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-44C8RWC-SH&_user=5731894&_coverDate=01/01/1985&_rdoc=28&_fmt=high&_orig=browse&_srch=doc-info(#toc#4938#1985#998209998#270526#FLP#display#Volume)&_cdi=4938&_sort=d&_docanchor=&_ct=40&_acct=C000043105&_version=1&_urlVersion=0&_userid=5731894&md5=f14f4734123ab1177d7217cab6c7ce7d FEBS Letters]
Kinetic information
Reversible Michaelis-Menten [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-44C8RWC-SH&_user=5731894&_coverDate=01/01/1985&_rdoc=28&_fmt=high&_orig=browse&_srch=doc-info(#toc#4938#1985#998209998#270526#FLP#display#Volume)&_cdi=4938&_sort=d&_docanchor=&_ct=40&_acct=C000043105&_version=1&_urlVersion=0&_userid=5731894&md5=f14f4734123ab1177d7217cab6c7ce7d FEBS Letters]
Additional information
extensive information on the structure and enzymatic properties of succinyl-CoA synthetase can be found at [https://proteopedia.org/wiki/index.php/Succinyl-Coa_Synthetase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]-[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]-[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
description
[Pubmed|22383849]
regulation
repressed by glucose (2.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|12850135]
expression is heterogeneous [pubmed|29809139]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]→[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]

2024-05-21 09:31:36

Jstuelk

63

167fd8fae94fab138af8eabe6101bc58adfb0921

2BC79D48E345B722DDAE396E448CF1DB3AAB049C

Other regulations
[protein|6AC80B5916EEA851E9A7AF586341C58B7E69D8E7|roxS]: translation inhibition, translation inhibition and initiation of RNA degradation by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|rnc]
Biological materials
Mutant
1A1006 [gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]::''spec'', available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1006&Search=1A1006 BGSC]
GP1134 (cat), available in [wiki|Jrg Stlke]'s lab
GP791 ([gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD])::''tet'', available in [wiki|Jrg Stlke]'s lab
GP2344 ([gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD])::''kan'', Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA], available in [wiki|Jrg Stlke]'s lab
GP2345 ([gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]::''lox72''), Cre-recombinase is integrated in [gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA], available in [wiki|Jrg Stlke]'s lab
BKE16090 ([gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC])::erm trpC2 available at [http://bgsc.org/getdetail.php?bgscid=BKE16090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCATCCTCCTAACT, downstream forward: _UP4_TAAGAAAGAATGAAAGGCAG
BKK16090 ([gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC])::kan trpC2 available at [http://bgsc.org/getdetail.php?bgscid=BKK16090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCATCCTCCTAACT, downstream forward: _UP4_TAAGAAAGAATGAAAGGCAG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
References
36815589,12850135,17218307,11976317,20933603,15378759,22900538,25643072,29809139

D72175937B3956C2BC500FC00CEC8EC57A0A76A8

Page visits: 5119

Time of last update: 2024-05-22 17:07:17

Author of last update: Jstuelk