

phosphoglycosyl transferase, extracellular polysaccharide synthesis

Molecular weight
22.93 kDa
Protein length
Gene length
biofilm formation
phosphoglycosyl transferase
epsL, yvfC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2148 (Galperin et al., 2021)

This gene is a member of the following regulons

3,516,880 → 3,517,488
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
UDP-N,N’-diacetylbacillosamine + undecaprenyl-phosphate --> undecaprenyl-PP-diNAcBac [pubmed|37650625]
Protein family
Bacterial sugar transferase family (with [protein|search|TuaA], according to UniProt)
[PDB|5W7L] (from Campylobacter concisus, 58% identity) [pubmed|29769739]
Paralogous protein(s)
[protein|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1], [protein|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]
cell membrane (according to UniProt)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A065 (yvfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/65 NBRP B. subtilis, Japan]
BKE34250 (Δ[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGATCAAAAAGTCGTTTCA,  downstream forward: _UP4_ACCGGAAGCGGAGATGTGTC
BKK34250 (Δ[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGATCAAAAAGTCGTTTCA,  downstream forward: _UP4_ACCGGAAGCGGAGATGTGTC
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
Research papers
The EAR [wiki|RNA switch]


Page visits: 4369

Time of last update: 2024-07-15 06:30:40

Author of last update: Jstuelk