

[metabolite|carbamoyl-P] synthetase (catalytic subunit)

Molecular weight
117.44 kDa
Protein length
Gene length
pyrimidine biosynthesis
[metabolite|carbamoyl-P] synthetase (catalytic subunit)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0458 (Galperin et al., 2021)

This gene is a member of the following regulons

1,623,736 → 1,626,951
Visit Visit
The protein
Catalyzed reaction/ biological activity
2 [metabolite|ATP] + H2O + [metabolite|bicarbonate] + L-[metabolite|glutamine] --> 2 [metabolite|ADP] + [metabolite|carbamoyl-P] + 2 H+ + L-[metabolite|glutamate] + [metabolite|phosphate] (according to UniProt)
Protein family
carB family (with [protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB], according to UniProt)
2 [wiki|ATP-grasp domain]s (aa 133-327, aa 671-861) (according to UniProt)
MGS-like domain (aa 930-1071) (according to UniProt)
[PDB|1JDB] (from ''Escherichia coli'', 49% identity, 69% similarity) [Pubmed|10089390]
Paralogous protein(s)
membrane [Pubmed|18763711]
Expression and Regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-18 17:36:24





Biological materials
BKE15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA,  downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
BKK15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA,  downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
GP3717 ([gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3719 ([gene|search|pyrAAAB]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3721 ([gene|search|pyrAAAB]::cat trpC2) available in the [wiki|Stülke] lab
Original Publications


Page visits: 2762

Time of last update: 2024-06-20 09:36:54

Author of last update: Jstuelk