pyrAB

pyrAB
168

[metabolite|carbamoyl-P] synthetase (catalytic subunit)

locus
BSU_15520
Molecular weight
117.44 kDa
pI
4.78
Protein length
Gene length
function
pyrimidine biosynthesis
product
[metabolite|carbamoyl-P] synthetase (catalytic subunit)
essential
no
ec
6.3.5.5
synonyms
pyrAB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0458 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,623,736 → 1,626,951
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2 [metabolite|ATP] + H2O + [metabolite|bicarbonate] + L-[metabolite|glutamine] --> 2 [metabolite|ADP] + [metabolite|carbamoyl-P] + 2 H+ + L-[metabolite|glutamate] + [metabolite|phosphate] (according to UniProt)
Protein family
carB family (with [protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB], according to UniProt)
[wiki|Domains]
2 [wiki|ATP-grasp domain]s (aa 133-327, aa 671-861) (according to UniProt)
MGS-like domain (aa 930-1071) (according to UniProt)
Structure
[PDB|1JDB] (from ''Escherichia coli'', 49% identity, 69% similarity) [Pubmed|10089390]
[AF|P25994]
Paralogous protein(s)
[protein|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2024-06-18 17:36:24

ghost

90

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

Biological materials
Mutant
BKE15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA,  downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
BKK15520 (Δ[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATTACTAAAATTTTGTTAA,  downstream forward: _UP4_AATCAGGAGGCGGCAGTCAC
GP3717 ([gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3719 ([gene|search|pyrAAAB]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3721 ([gene|search|pyrAAAB]::cat trpC2) available in the [wiki|Stülke] lab
References
Reviews
12859215,11395405,11163353
Original Publications
8206849,1709162,18763711,10089390,8663035

D57DC8A53E52BC4A2EA894E3C9FD983592882918

Page visits: 2811

Time of last update: 2024-07-15 01:06:34

Author of last update: Jstuelk