cysK

cysK
168

cysteine synthase, trigger enzyme, acts as corepressor for [protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]

locus
BSU_00730
Molecular weight
32.67 kDa
pI
5.49
Protein length
Gene length
function
biosynthesis of cysteine, control of [protein|50930C56C27D22715620A350220E3C56ADB41020|cymR] activity
product
cysteine synthase
essential
no
ec
2.5.1.47
synonyms
cysK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0031 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
81,771 82,697
Phenotypes of a mutant
constitutive expression of the genes of the [regulon|CymR regulon]
a [gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA] [gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK] double mutant is auxotrophic for cysteine [pubmed|17056751]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
O(3)-acetyl-L-serine + H2S --> L-cysteine + acetate (according to UniProt)
Protein family
Cysteine synthase/cystathionine beta-synthase family (with [protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA] and [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP], according to UniProt)
[wiki|Cofactors]
PLP (according to Swiss-Prot)
Structure
[PDB|2EGU] (from Geobacillus kaustophilis, 84% identity)
[PDB|1Y7L] (from ''Haemophilus influenzae'', 39% identity, 52% similarity) [Pubmed|15838047]
[AF|P37887]
Paralogous protein(s)
[protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA], [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP]
[wiki|Localization]
cytoplasm (according to UniProt)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]-[gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]-[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
description
[Pubmed|22383849]
regulation
induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|spx]) [pubmed|30480837]
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30480837], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]→[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]

2024-05-22 21:53:57

Jstuelk

107

9ef1e909d5470f714eecab6c2a37a360ff5a937a

003644EA8BBEA39BF437B882590C41426A16D68B

genes
[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
description
[Pubmed|9084182]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16513748], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [Pubmed|12642660,19575568], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11445163], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]

2024-05-21 13:14:38

ghost

62

39f1c124b5522da23540e3707675b8dfdac1d535

3D7A683C64E1C94E02DED689C80BD7981FC39ADF

Biological materials
Mutant
1A834 ( ''cysK''::''kan''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A834&Search=1A834 BGSC]
1A801 ( ''cysK''::''spec''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A801&Search=1A801 BGSC]
1A803 ( ''cysK''::''spec''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A803&Search=1A803 BGSC]
1A946 ( ''cysK''::''spec''), [Pubmed|17056751], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A946&Search=1A946 BGSC]
BKE00730 ([gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGACACCTCAATTT, downstream forward: _UP4_TAAAAAAAGCCAAAACTCCC
BKK00730 ([gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGACACCTCAATTT, downstream forward: _UP4_TAAAAAAAGCCAAAACTCCC
labs
[[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
References
16513748,17056751,18974048,16267287,12642660,11445163,12107147,15838047,9084182,15378759

D1FC976597E5583E40A4ED7234FBCA743AB01354

Page visits: 6215

Time of last update: 2024-05-23 10:21:41

Author of last update: Jstuelk