

[wiki|RNA polymerase] forespore-specific (early) [wiki|sigma factor] SigF

Molecular weight
29.22 kDa
Protein length
Gene length
transcription of [wiki|sporulation] genes (early forespore)
[wiki|RNA polymerase] forespore-specific (early) [wiki|sigma factor] SigF
sigF, spoIIAC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1191 (Galperin et al., 2021)

This gene is a member of the following regulons

2,443,429 → 2,444,196
Visit Visit
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
[PDB|1L0O] (complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB], Geobacillus stearothermophilus) [pubmed|11955433]
Paralogous protein(s)
Expression and Regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab


2024-07-03 09:04:04





''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2024-07-04 03:41:30





Biological materials
BKE23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC,  downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
BKK23450 (Δ[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCACATCCATAACAAATC,  downstream forward: _UP4_TAGTCTGCAGTGCAGGCTAG
[wiki|Charles Moran], Emory University, NC, USA [ homepage]
Original Publications
The [wiki|SigF regulon]


Page visits: 12575

Time of last update: 2024-07-16 00:35:26

Author of last update: Jstuelk