speD

speD
168

[metabolite|S-adenosylmethionine] decarboxylase, required for biofilm formation

locus
BSU_29010
Molecular weight
13.96 kDa
pI
4.77
Protein length
Gene length
function
[metabolite|spermidine], polyamine biosynthesis
product
[metabolite|S-adenosylmethionine] decarboxylase
essential
no
ec
4.1.1.50
synonyms
speD, ytcF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1586 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,966,413 → 2,966,793
Phenotypes of a mutant
no [wiki|biofilm formation] [Pubmed|24529384]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
H+ + [metabolite|S-adenosyl-L-methionine] --> CO2 + [metabolite|S-adenosyl-L-methioninamine] (according to UniProt)
Protein family
prokaryotic AdoMetDC family (single member, according to UniProt)
Structure
[PDB|1VR7] (from ''Thermotoga maritima'', 47% identity, 72% similarity)
[AF|O34426]
Expression and Regulation
Operons
genes
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]-[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
description
[Pubmed|15720552]
regulation
[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]: repressed in the presence of glucose ([protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]) [Pubmed|15720552]
regulatory mechanism
[protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]: repression, [Pubmed|15720552], in [regulon|protein:2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15720552], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]: the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic [gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD] mRNA increases from 1.4 to 36 min) [PubMed|21815947]
Open in new tab

[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]→[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]

2024-06-16 01:39:57

Jstuelk

79

FD19E158AAF06F7ED8F02CFEE19CA4A6483E5FCD

2E200F04B473223099E032055E071DE51C38D7C2

genes
[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]
description
[Pubmed|10844697]
additional information
[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]: the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the monocistronic [gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD] mRNA increases from 1.4 to 36 min) [PubMed|21815947]
Open in new tab

[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]

2024-06-20 19:50:10

Jstuelk

54

5BB5A0EEC359A42ABEC36C427E4A396052596EDA

680CA8DB921CD01E59CC00D1733B359F825C21A8

Biological materials
Mutant
MGNA-A122 (ytcF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/122 NBRP B. subtilis, Japan]
BKE29010 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTCATGGACCCCCCTT,  downstream forward: _UP4_TAAAGTAAATTGCGAACACA
BKK29010 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTCATGGACCCCCCTT,  downstream forward: _UP4_TAAAGTAAATTGCGAACACA
GP2599 (Δ[gene|CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED|speD]::tet comIQ12L) (in DK1042), available in [wiki|Jörg Stülke]'s lab
References
10844697,15720552,9723923,21815947,24529384,28546427

CDD5C7B1CE58352D29BB86BCC2C3685D1D8898ED

Page visits: 3719

Time of last update: 2024-06-20 19:11:57

Author of last update: Jstuelk