

involved in the activation of biofilm matrix biosynthetic operons, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

Molecular weight
5.80 kDa
Protein length
Gene length
regulation of [wiki|biofilm formation]
regulator of the extracellular matrix
remB, yaaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

4,567 → 4,812
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
Visit Visit
The protein
Expression and Regulation
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2987848], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-08 17:54:59





Biological materials
MGNA-B880 (yaaB::erm), available at the [ NBRP B. subtilis, Japan]
BKE00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT,  downstream forward: _UP4_TAGAAATTTTTTATCACGAA
BKK00050 (Δ[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACAATTGCTCACCTCATT,  downstream forward: _UP4_TAGAAATTTTTTATCACGAA
[wiki|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]


Page visits: 3836

Time of last update: 2024-07-12 01:19:45

Author of last update: Jstuelk